Phosphocreatine comes up often in conversation and rarely with the context attached. Here we lay out the basics in order, then work through the practical considerations.
Last reviewed on 2025-10-30. Where a claim depends on a specific study, the study is described rather than over-claimed.
Quality control for creatine monohydrate begins with identity confirmation and assay determination. Laboratories commonly use high-performance liquid chromatography with ultraviolet detection, often after derivatization or using a suitable column, to quantify creatine. Karl Fischer titration measures water content, which helps verify the monohydrate stoichiometry. Additional tests screen for heavy metals, residual solvents, and microbial contamination depending on the intended use. These tests establish composition and purity rather than biological effect.
Stability studies examine how creatine monohydrate changes under controlled temperature and humidity. The solid is generally stable when kept dry, but moisture can promote hydrolysis to creatinine, especially in solution or at elevated temperatures. Color, odor, and assay values are monitored over time to detect degradation. Because degradation pathways depend on storage conditions, shelf-life claims should specify the tested packaging, temperature, and humidity. Open questions remain about the long-term behavior of different crystal habits and particle sizes.
The compound was identified in the nineteenth century after chemists isolated a nitrogenous substance from meat extracts. Later work established its role in muscle energy metabolism and its conversion to phosphocreatine. Chemical synthesis of creatine followed, and industrial production made the monohydrate widely available as a purified powder. Interest expanded in the late twentieth century when researchers began studying creatine supplementation and muscle physiology. Historical accounts sometimes differ on exact dates and attributions, but the broad sequence from tissue extracts to synthetic production is well documented.
In the body, creatine is obtained from dietary meat and fish and is also synthesized from arginine, glycine, and methionine. Muscle stores creatine and phosphocreatine, which participate in the rapid regeneration of adenosine triphosphate during short, intense activity. The monohydrate form is used in research because it is chemically defined, stable as a dry solid, and relatively inexpensive to produce. Questions remain about whether other creatine forms offer meaningful advantages in absorption or tissue retention, and findings vary across studies and populations.
Creatine monohydrate is a crystalline compound formed from creatine and one molecule of water. Creatine itself is a nitrogen-containing organic acid that occurs in vertebrate muscle and other tissues. The monohydrate designation refers to the water included in the crystal lattice, not to water added during manufacturing. Its chemical formula is commonly written as C4H9N3O2·H2O. The solid is typically a white, odorless powder with low solubility in water at room temperature. It is one of several creatine forms described in scientific and commercial literature.
| Property | Value | Notes |
|---|---|---|
| Common synonyms | Creatine hydrate; N-carbamimidoyl-N-methylglycine monohydrate | Synonyms vary by naming convention |
| Typical assay method | HPLC-UV | Often paired with a reference standard |
| Water content method | Karl Fischer titration | Confirms monohydrate stoichiometry |
| Degradation product | Creatinine | Forms more readily in solution and with heat |
| Typical storage temperature | 15–25 °C | Keep dry and away from direct sunlight |
Several creatine forms are sold, including monohydrate, anhydrous, hydrochloride, nitrate, citrate, and blends. Once dissolved, these forms deliver creatine, but they differ in molar mass, solubility, counterions, and water content. Creatine monohydrate has the largest body of published human data among these forms. Questions remain about whether any alternative form offers meaningful advantages in absorption, tolerability, or tissue uptake under practical conditions. The hydrate form's lower creatine content by mass is a compositional fact, not a statement about effectiveness.
Creatine monohydrate is a crystalline compound formed when one molecule of creatine associates with one molecule of water in the solid lattice. Its molecular formula is C4H11N3O3, and its molar mass is about 149.15 grams per mole. The material appears as a white, odorless powder that dissolves sparingly in water at room temperature. The monohydrate designation distinguishes it from anhydrous creatine, which lacks the bound water and has a lower molar mass. This hydrate is the most common commercial form of creatine used in nutritional and research settings.
Creatine is synthesized endogenously in humans, mainly in the liver, kidney, and pancreas, from the amino acids arginine, glycine, and methionine. Skeletal muscle stores much of the body's creatine, where it participates in the phosphocreatine system that buffers adenosine triphosphate during short, intense contractions. Dietary sources include meat and fish, so omnivorous diets provide additional creatine beyond endogenous production. Supplemental creatine monohydrate supplies the same molecule found in food and tissues, not a distinct drug or hormone. Research interest centers on its role in cellular energy transfer and its effects on muscle and other tissues.
Quality assessment of creatine monohydrate typically uses high-performance liquid chromatography to separate creatine from creatinine and other impurities. Other methods include nuclear magnetic resonance spectroscopy, titration, and infrared spectroscopy for identity confirmation. Purity is often reported as a percentage of the labeled compound on a dry basis, while moisture content is measured separately. Because different analytical methods have different selectivity, comparing purity values across sources requires attention to the method and sample preparation.
In dry solid form, creatine monohydrate is relatively stable when protected from moisture and heat. The crystal lattice includes water, and exposure to high humidity can cause caking or gradual changes in powder flow. Elevated temperatures may accelerate decomposition, particularly if moisture is present. Studies generally report that sealed, dry material retains acceptable purity for extended periods, although exact shelf life depends on packaging and storage conditions. Light exposure is not usually considered a major factor for this compound.
In aqueous solution, creatine monohydrate exists mainly as a zwitterion, carrying both a positive guanidinium charge and a negative carboxylate charge. This charge separation raises water solubility relative to many neutral organic solids and helps explain its behavior in analytical separations. The monohydrate can lose its water of crystallization under sustained heat or low humidity, converting toward anhydrous creatine. Such transitions matter for mass balance calculations because the hydrate contributes water mass that is not part of the active creatine molecule.
The term creatine monohydrate is often shortened to creatine in casual usage, though other creatine forms exist, including citrate, nitrate, and hydrochloride salts. These alternative forms differ in solubility, pH behavior, and the amount of creatine delivered per unit mass. Regulatory categories vary by country: some jurisdictions treat it as a food ingredient, while others place it under supplement or drug frameworks depending on claims and presentation. Standard reference texts list it as a naturally occurring nitrogenous organic acid rather than a vitamin or mineral.
Creatine monohydrate is a crystalline organic compound formed from creatine and water in a one-to-one ratio. It belongs to the guanidino family and contains a methylated guanidine group attached to an acetate-like chain. The solid is commonly described as a white, odorless powder with a mildly bitter taste. Its molecular formula is C4H11N3O3·H2O, and the hydrated form is the most widely traded grade. The compound occurs naturally in vertebrate muscle and brain tissue, where it participates in rapid energy buffering.
Creatine monohydrate is sold as a dietary ingredient in some countries and as a food supplement in others. Regulatory frameworks vary, so purity limits, labeling rules, and permitted claims are not globally uniform. In the United States, it falls under dietary supplement rules, whereas the European Union treats it as a food supplement ingredient. Pharmacopeial monographs, where they exist, can provide public quality standards, but not every product is required to meet them. Questions about long-term effects and patterns of use remain areas of active study rather than settled regulatory findings.
Solid creatine monohydrate is generally stable when kept cool and dry, but it can hydrolyze to creatinine over time. Moisture, heat, and acidic conditions accelerate this conversion, which reduces assay values and changes the material's properties. Creatinine is a cyclic dehydration product that is also a normal human metabolite, so its presence in a sample is not necessarily a health concern by itself. In quality testing, creatinine is monitored as a marker of degradation and purity.
== Natural products == Despite the large number of species, the secondary metabolites of Russula have not been well investigated, especially compared to Lactarius. Russula foetens was shown to produce the marasmane sesquiterpenes Lactapiperanol A and Lactapiperanol E. A novel lectin with potent in vitro antitumor activity was isolated from Russula rosea, the first lectin reported from a Russula. This mushroom is also the source of the sesquiterpenes rulepidanol and rulepidadienes A and B. Russula nigricans contains the compound nigricanin, the first ellagic acid derivative isolated from higher fungi.
=== Fear processing === The medial zone of hypothalamus is part of a circuitry that controls motivated behaviors, like defensive behaviors. Analyses of Fos-labeling showed that a series of nuclei in the "behavioral control column" is important in regulating the expression of innate and conditioned defensive behaviors.
=== Motivational disorders === Levodopa has been found to increase the willingness to exert effort for rewards in humans and hence appears to show pro-motivational effects. Other dopaminergic agents have also shown pro-motivational effects and may be useful in the treatment of motivational disorders.
Accumulation of amyloid proteins in the gastrointestinal system may be caused by a wide range of amyloid disorders and have different presentations depending on the degree of organ involvement. Potential symptoms include weight loss, diarrhea, abdominal pain, heartburn (gastrointestinal reflux), and GI bleeding. Amyloidosis may also affect accessory digestive organs including the liver, and may present with jaundice, fatty stool, anorexia, fluid buildup in the abdomen, and spleen enlargement. Accumulation of amyloid proteins in the liver can lead to elevations in serum aminotransferases and alkaline phosphatase, two biomarkers of liver injury, which is seen in about one third of people. Liver enlargement is common. In contrast, spleen enlargement is rare, occurring in 5% of people. Splenic dysfunction, leading to the presence of Howell-Jolly bodies on blood smear, occurs in 24% of people with amyloidosis. Malabsorption is seen in 8.5% of AL amyloidosis and 2.4% of AA amyloidosis. One suggested mechanism for the observed malabsorption is that amyloid deposits in the tips of intestinal villi (fingerlike projections that increase the intestinal area available for absorption of food), begin to erode the functionality of the villi, presenting a sprue-like picture.
Sources: en.wikipedia.org
== Role in protein folding == Two hypotheses have been proposed for the role of turns in protein folding. In one view, turns play a critical role in folding by bringing together and enabling or allowing interactions between regular secondary structure elements. This view is supported by mutagenesis studies indicating a critical role for particular residues in the turns of some proteins. Also, nonnative isomers of X−Pro peptide bonds in turns can completely block the conformational folding of some proteins. In the opposing view, turns play a passive role in folding. This view is supported by the poor amino-acid conservation observed in most turns. The non-native isomers of many X−Pro peptide bonds in turns also have little or no effect on folding.
== Mechanical properties == The ongoing research has shown that mechanical properties can vary significantly in nanomaterials compared to bulk material. Nanomaterials have substantial mechanical properties due to the volume, surface, and quantum effects of nanoparticles. This is observed when the nanoparticles are added to common bulk material, the nanomaterial refines the grain and forms intergranular and intragranular structures which improve the grain boundaries and therefore the mechanical properties of the materials. Grain boundary refinements provide strengthening by increasing the stress required to cause intergranular or transgranular fractures. A common example where this can be observed is the addition of nano Silica to cement, which improves the tensile strength, compressive strength, and bending strength by the mechanisms just mentioned. The understanding of these properties will enhance the use of nanoparticles in novel applications in various fields such as surface engineering, tribology, nanomanufacturing, and nanofabrication. Techniques used: Steinitz in 1943 used the micro-indentation technique to test the hardness of microparticles, and now nanoindentation has been employed to measure elastic properties of particles at about 5-micron level. These protocols are frequently used to calculate the mechanical characteristics of nanoparticles via atomic force microscopy (AFM) techniques. To measure the elastic modulus; indentation data is obtained via AFM force-displacement curves being converted to force-indentation curves.
The 70 kilodalton heat shock proteins (Hsp70s or DnaK) are a family of conserved ubiquitously expressed heat shock proteins. Proteins with similar structure exist in virtually all living organisms and play crucial roles in the development of cancer, neurodegeneration, apoptosis, regulating sleep, and much more. Intracellularly localized Hsp70s are an important part of the cell's machinery for protein folding, performing chaperoning functions, and helping to protect cells from the adverse effects of physiological stresses. Additionally, membrane-bound Hsp70s have been identified as a potential target for cancer therapies and their extracellularly localized counterparts have been identified as having both membrane-bound and membrane-free structures. There is lot of potential in the Hsp70 protein as a key therapeutic target for developing new drugs for the treatment of sleep disorders, cancer, neurodegeneration, and other related pathological conditions.
=== Autism === Compared to placebo, risperidone treatment reduces certain problematic behaviors in autistic children, including aggression toward others, self-injury, challenging behavior, and rapid mood changes. The evidence for its efficacy appears to be greater than that for alternative pharmacological treatments. The risk of rapid weight gain is an important consideration when prescribing it. Some authors recommend limiting the use of risperidone and aripiprazole to those with the most challenging behavioral disturbances to minimize the risk of drug-induced adverse effects. Evidence for the efficacy of risperidone in autistic adolescents and young adults is less persuasive.
=== March === 1 March – Statistics released by the Scottish Government indicate Scotland's economy grew by 0.1% during the three months from October–December 2022. 2 March – Minister for Transport Jenny Gilruth announces plans to nationalise the overnight Caledonian Sleeper train service that links London with several locations in Scotland, taking effect from 25 June. 3 March The Educational Institute of Scotland and other teaching unions call off a planned 20 days of rolling strikes scheduled to begin on 13 March after receiving an improved pay offer from the Scottish Government, worth 14.6% over 28 months. The proposals will now be put to a ballot. Loganair announces it will suspend flights between Inverness Airport and some island airports for at least six weeks from 17 March because of industrial action scheduled to begin at Highland and Islands Airports Limited. 6 March – BBC News reports that the Scottish Prison Service is to be investigated for corporate manslaughter over the death of Allan Marshall, a prisoner at HMP Edinburgh, who died after being restrained by 13 prison officers in 2015. 7 March – STV hosts the first televised debate of the Scottish National Party leadership election. 10 March – Members of Scotland's largest teaching union, the Educational Institute of Scotland, vote to accept a pay deal from the Scottish Government that will end ongoing strikes in schools. 13 March – Voting opens in the Scottish National Party leadership election.
Sources: en.wikipedia.org
In pre-life, a 31 nucleotide D loop minihelix (GCGGCGGUAGCCUAGCCUAGCCUACCGCCGC) was ligated to two 31 nucleotide anticodon loop minihelices (GCGGCGGCCGGGCU/???AACCCGGCCGCCGC; / indicates a U-turn conformation in the RNA backbone; ? indicates unknown base identity) to form the 93 nucleotide tRNA precursor. To generate type II tRNAs, a single internal 9 nucleotide deletion occurred within ligated acceptor stems (CCGCCGCGCGGCGG goes to GGCGG). To generate type I tRNAs, an additional, related 9 nucleotide deletion occurred within ligated acceptor stems within the variable loop region (CCGCCGCGCGGCGG goes to CCGCC). These two 9 nucleotide deletions are identical on complementary RNA strands. tRNAomes (all of the tRNAs of an organism) were generated by duplication and mutation. Very clearly, life evolved from a polymer world that included RNA repeats and RNA inverted repeats (stem-loop-stems). Of particular importance were the 7 nucleotide U-turn loops (CU/???AA). After LUCA (the last universal common (cellular) ancestor), the T loop evolved to interact with the D loop at the tRNA "elbow" (T loop: UU/CAAAU, after LUCA). Polymer world progressed to minihelix world to tRNA world, which has endured for ~4 billion years. Analysis of tRNA sequences reveals a major successful pathway in evolution of life on Earth.
=== Cell integrity loss === Cell integrity loss is caused by bacteria releasing dissolved algicidal compounds, which are toxic to algae, into the surrounding water, causing rapid cell lysis of algae cells. Cell lysis occurs when algicidal enzymes or small molecules degrade cell walls and membranes, causing structural collapse. While most compounds released by algicidal bacteria cause cell lysis by damaging the algae cells walls, other lysis inducing mechanisms can include ion permeability disruption, and acidification of the cytoplasm by small molecules passing through the cell wall. An example of a bacterium which causes cell integrity loss is a strain of Alteromonas abrolhosensis, named JY‑JZ1, which when cultured, showed strong algicidal activity. Through microscopy, researchers found that algal cells exposed to this bacterium had damaged cell membranes and leaked intracellular contents which indicates cell death by lysis.
== Diagnosis == Early diagnosis of SCID is usually difficult due to the need for advanced screening techniques. Several symptoms may indicate a possibility of SCID in a child, such as a family history of infant death, chronic coughs, hyperinflated lungs, and persistent infections. A full blood lymphocyte count is often considered a reliable manner of diagnosing SCID, but higher lymphocyte counts in childhood may influence results. Clinical diagnosis based on genetic defects is also a possible diagnostic procedure that has been implemented in the UK. Some SCID can be detected by sequencing fetal DNA if a known history of the disease exists. Otherwise, SCID is not diagnosed until about six months of age, usually indicated by recurrent infections. The delay in detection is because newborns carry their mothers' antibodies for the first few weeks of life and SCID babies look normal.
The third phase follows at 3 to 5 days, and is marked by complications of massive liver necrosis leading to fulminant liver failure with complications of coagulation defects, low blood sugar, kidney failure, hepatic encephalopathy, brain swelling, sepsis, multiple organ failure, and death. If the third phase is survived, the liver necrosis runs its course, and liver and kidney function typically return to normal in a few weeks. The severity of paracetamol toxicity varies depending on the dose and whether appropriate treatment is received.
This complication may manifest as systemic infections, such as sepsis, or as localized outbreaks, such as Herpes simplex, shingles, or other members of the Herpesviridea. The risk of illness and death can be reduced by taking common antibiotics such as quinolones or trimethoprim/sulfamethoxazole before any fever or sign of infection appears. Quinolones show effective prophylaxis mainly with hematological cancer. However, in general, for every five people who are immunosuppressed following chemotherapy who take an antibiotic, one fever can be prevented; for every 34 who take an antibiotic, one death can be prevented. Sometimes, chemotherapy treatments are postponed because the immune system is suppressed to a critically low level. In Japan, the government has approved the use of some medicinal mushrooms like Trametes versicolor, to counteract depression of the immune system in people undergoing chemotherapy. Trilaciclib is an inhibitor of cyclin-dependent kinase 4/6 approved for the prevention of myelosuppression caused by chemotherapy. The drug is given before chemotherapy to protect bone marrow function.
Sources: en.wikipedia.org
Karl Fischer titration is a standard method for measuring water content in solid and liquid samples. The result helps confirm the expected monohydrate stoichiometry. Loss-on-drying can also indicate moisture but may not distinguish water from other volatile substances.
Creatinine forms through irreversible cyclization and loss of water from creatine, and the rate increases with temperature, moisture, and pH changes. In dry solid form, the reaction is slow. In solution, degradation can become noticeable over time.
A specification typically lists assay range, water content, appearance, identification, and limits for heavy metals, residual solvents, and microbial counts. It may also include particle size distribution or bulk density for handling purposes. These parameters are distinct from any claimed performance effect.
It is a crystalline form of creatine that contains one water molecule per creatine molecule. The compound occurs naturally in muscle tissue and is also produced synthetically for research and consumer products. The monohydrate label describes the solid's hydration state.